CITED2 inframe variants in ExAC


The table below lists the CITED2 inframe variants found in the ExAC population database. Click on each variant for more details, including presence in the 1000 Genomes and Exome Sequencing Project databases, a breakdown by ethnic class and the variant's role in inherited cardiac disease. Use the form below to customise the variant selection. The table can be sorted by variant location, variant type or ExAC frequency.




No. Genomic coord. Variant (CDS) Variant (Protein) Variant Type ExAC frequencyPopulations*
1. 139694523 c.559_586delGCGGGCAGCAGCAACAGCGGCGGCGGCAinsGCGGGCAGCAGCAACAGCGGCA p.Gly194_Gly195del inframe 0.00136080
2. 139694965 c.117_119delCCA p.H39_Q40delinsQ inframe 0.00135393
3. 139694508 c.574_579delAGCGGC inframe 0.00045391
4. 139694489 c.593_598delGCGGCA inframe 0.00040301
5. 139694489 c.593_598dupGCGGCA p.Ser198_Gly199dup inframe 0.00012184
6. 139694954 c.128_130delAGC p.Gln43del inframe 0.00002505
7. 139694523 c.559_585delGCGGGCAGCAGCAACAGCGGCGGCGGC p.Ala187_Gly195del inframe 0.00001987
8. 139694954 c.128_130dupAGC p.Gln43dup inframe 0.00001670
9. 139694523 c.559_586delGCGGGCAGCAGCAACAGCGGCGGCGGCAinsGCGGGCAGCAGCAACAGCGGCGGCGGCGGCGGCA p.Gly194_Gly195dup inframe 0.00000993
10. 139694508 c.574_594delAGCGGCGGCGGCAGCGGCAGC p.Ser192_Ser198del inframe 0.00000992
11. 139694561 c.521_523dupGCA p.Ser174dup inframe 0.00000967
12. 139694509 c.573_574insAGCGGC p.Ser192_Gly193dup inframe 0.00000946
13. 139694652 c.430_435delCACCAG p.His144_Gln145del inframe 0.00000838

* This highlights the relative frequency of the variant in the ExAC populations - Non-Finnish European, African, East Asian, South Asian, American and Finnish. Higher frequencies are denoted by darker shades of green, variants absent in a population are coloured light gray.

Genomic coordinates refer to the GRCh37 release of the human genome.