F7 splice variants in ExAC

F7 gene summary
F7 variants in

The table below lists the F7 splice variants found in the ExAC population database. Click on each variant for more details, including presence in the 1000 Genomes and Exome Sequencing Project databases, a breakdown by ethnic class and the variant's role in inherited cardiac disease. Use the form below to customise the variant selection. The table can be sorted by variant location, variant type or ExAC frequency.




No. Genomic coord.✝ Variant (CDS)▼ Variant (Protein) Variant Type▼ ExAC frequency▼Populations*
1. 113760228 c.64+9G>A splice site 0.20961193●●●●●●
2. 113771917 c.805+7A>G splice site 0.01200299●●●●●●
3. 113772717 c.806-10T>C splice site 0.00525005●●●●●●
4. 113760227 c.64+8C>T splice site 0.00521930●●●●●●
5. 113761156 c.65-3C>T splice site 0.00151815●●●●●●
6. 113760223 c.64+4C>T splice site 0.00074789●●●●●●
7. 113761160 c.66C>T p.G22G splice site 0.00051908●●●●●●
8. 113771918 c.805+8_805+44delCCACTCTCCCCTGTCCGACCGCGGTGCTGGGTGGGTG splice site 0.00019132●●●●●●
9. 113768273 c.429G>A p.T143T splice site 0.00009971●●●●●●
10. 113761231 c.130+7A>T splice site 0.00006763●●●●●●
11. 113765000 c.131-4C>A splice site 0.00005871●●●●●●
12. 113771781 c.682-6G>A splice site 0.00004961●●●●●●
13. 113771918 c.805+8C>A splice site 0.00003323●●●●●●
14. 113771780 c.682-7C>T splice site 0.00002480●●●●●●
15. 113768060 c.292-6C>T splice site 0.00001648●●●●●●
16. 113772728 c.807C>A splice site 0.00000895●●●●●●
17. 113772728 c.807C>T p.G269G splice site 0.00000895●●●●●●
18. 113768280 c.430+6G>T splice site 0.00000835●●●●●●
19. 113768281 c.430+7C>T splice site 0.00000835●●●●●●
20. 113771193 c.681+4A>G splice site 0.00000834●●●●●●
21. 113771075 c.572-5delC splice site 0.00000830●●●●●●
22. 113771779 c.682-8C>T splice site 0.00000827●●●●●●
23. 113771782 c.682-5C>T splice site 0.00000827●●●●●●
24. 113771783 c.682-4C>T splice site 0.00000827●●●●●●
25. 113768097 c.316+7G>T splice site 0.00000824●●●●●●

* This highlights the relative frequency of the variant in the ExAC populations - Non-Finnish European, African, East Asian, South Asian, American and Finnish. Higher frequencies are denoted by darker shades of green, variants absent in a population are coloured light gray.

✝ Genomic coordinates refer to the GRCh37 release of the human genome.