LDB3 truncating variants in ExAC

LDB3 gene summary
LDB3 variants in DCM

The table below lists the LDB3 truncating variants found in the ExAC population database with a mean allelic frequency (MAF) less than 0.0001, classified for this study as a rare variant. Click on each variant for more details, including presence in the 1000 Genomes and Exome Sequencing Project databases, a breakdown by ethnic class and the variant's role in inherited cardiac disease. Use the form below to customise the variant selection. The table can be sorted by variant location, variant type or ExAC frequency.




No. Genomic coord.✝ Variant (CDS)▼ Variant (Protein) Variant Type▼ ExAC frequency▼Populations*
1. 88441526 c.655C>T p.R219X nonsense 0.00003486●●●●●●
2. 88452309 c.877G>T p.E293X nonsense 0.00000824●●●●●●
3. 88469728 c.1152C>A p.Y384X nonsense 0.00000854●●●●●●
4. 88476473 c.1621C>T p.R541X nonsense 0.00000881●●●●●●
5. 88477784 c.1740C>A p.C580X nonsense 0.00000824●●●●●●
6. 88477842 c.1798C>T p.R600X nonsense 0.00004942●●●●●●
7. 88492668 c.2119C>T p.Q707X nonsense 0.00000892●●●●●●
8. 88439915 c.321+1G>A essential splice site 0.00001679●●●●●●
9. 88441561 c.689+1G>A essential splice site 0.00000893●●●●●●
10. 88477720 c.1677-1G>A essential splice site 0.00001655●●●●●●
11. 88451707 c.744_745delTG p.Val249AspfsTer2 frameshift 0.00000824●●●●●●
12. 88451727 c.764_765insGCCAGAACAT p.Asp258HisfsTer5 frameshift 0.00000824●●●●●●
13. 88466336 c.945_972delGCTGCTGCCCGCTTCTGCCCAGCCACCT p.Ala319LeufsTer164 frameshift 0.00000838●●●●●●
14. 88466398 c.1007delT p.Leu336ArgfsTer156 frameshift 0.00002522●●●●●●
15. 88476368 c.1516delA p.Thr506ProfsTer59 frameshift 0.00000827●●●●●●
16. 88478508 c.1882delA p.Thr628HisfsTer75 frameshift 0.00000824●●●●●●
17. 88485941 c.2026delG p.Val676TrpfsTer27 frameshift 0.00000824●●●●●●

* This highlights the relative frequency of the variant in the ExAC populations - Non-Finnish European, African, East Asian, South Asian, American and Finnish. Higher frequencies are denoted by darker shades of green, variants absent in a population are coloured light gray.

✝ Genomic coordinates refer to the GRCh37 release of the human genome.