MMP9 truncating variants in ExAC

MMP9 gene summary
MMP9 variants in

The table below lists the MMP9 truncating variants found in the ExAC population database. Click on each variant for more details, including presence in the 1000 Genomes and Exome Sequencing Project databases, a breakdown by ethnic class and the variant's role in inherited cardiac disease. Use the form below to customise the variant selection. The table can be sorted by variant location, variant type or ExAC frequency.




No. Genomic coord.✝ Variant (CDS)▼ Variant (Protein) Variant Type▼ ExAC frequency▼Populations*
1. 44640295 c.906C>A p.C302X nonsense 0.00014846●●●●●●
2. 44641171 c.1280_1281insG p.Pro429AlafsTer5 frameshift 0.00011541●●●●●●
3. 44642364 c.1679G>A p.W560X nonsense 0.00010063●●●●●●
4. 44639866 c.734delC p.Thr246ProfsTer92 frameshift 0.00009949●●●●●●
5. 44641982 c.1419_1420insA p.Thr474AsnfsTer71 frameshift 0.00006764●●●●●●
6. 44639670 c.630G>A p.W210X nonsense 0.00004126●●●●●●
7. 44641175 c.1284_1285insC p.His432AlafsTer2 frameshift 0.00003298●●●●●●
8. 44642436 c.1750+1G>T essential splice site 0.00002569●●●●●●
9. 44641069 c.1178_1179delAC p.Tyr393Ter frameshift 0.00002482●●●●●●
10. 0 c.5710_997+21delGAGGTACCTCCACCCTGTCTACCA essential splice site 0.00001889●●●●●●
11. 44642117 c.1554_1555insA p.Asn519LysfsTer26 frameshift 0.00001687●●●●●●
12. 44639932 c.800delG p.Phe268LeufsTer70 frameshift 0.00001675●●●●●●
13. 44641064 c.1175-2A>G essential splice site 0.00001658●●●●●●
14. 44640211 c.824-2A>G essential splice site 0.00001650●●●●●●
15. 44640383 c.994C>T essential splice site 0.00000945●●●●●●
16. 44640383 c.994C>A essential splice site 0.00000945●●●●●●
17. 44639957 c.823+2T>A essential splice site 0.00000851●●●●●●
18. 44642151 c.1588C>T p.Q530X nonsense 0.00000848●●●●●●
19. 44640775 c.998-1G>A essential splice site 0.00000843●●●●●●
20. 44640774 c.998-2A>T essential splice site 0.00000843●●●●●●
21. 44642310 c.1625_1626delTC p.Ser543Ter frameshift 0.00000842●●●●●●
22. 44640954 c.1174+2T>C essential splice site 0.00000837●●●●●●
23. 44642391 c.1706C>A p.S569X nonsense 0.00000835●●●●●●
24. 44639168 c.418delG p.Ala140ProfsTer12 frameshift 0.00000827●●●●●●
25. 44639120 c.372-2A>G essential splice site 0.00000827●●●●●●

* This highlights the relative frequency of the variant in the ExAC populations - Non-Finnish European, African, East Asian, South Asian, American and Finnish. Higher frequencies are denoted by darker shades of green, variants absent in a population are coloured light gray.

✝ Genomic coordinates refer to the GRCh37 release of the human genome.