Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 240

Details for Exon 240 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 240 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,495,094 179,494,968 205,436 205,56244,155 44,281

Transcripts

Exon 240 occurs in the following Titin transcripts (the number indicates the exon rank of exon 240 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
239 189 67 188 68 68 -

Functional Data

Region: This exon occurs in the I-band region of the titin protein.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 96% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-ES20JT01288c.44281C>Tp.Pro14761Serother splice site
STM 2015DCM-ES20MC01968c.44281+1G>Aessential splice site

Sequence

Size of Exon: 127 bases           Ensembl ID: ENSE00002319532

GATTGTGAAATTAAGGAAGAAGGCAAAATACACTCCCTTGTTTTGCACAACTGTCGCCTGGACCAGACGGGTGGGGTGGATTTCCAAGCTGCCAATGTTAAATCTAGTGCCCACCTCCGA
GTTAAGC

ATGC = coding sequence, ATGC = non-coding sequence