Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 305

Details for Exon 305 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 305 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,456,231 179,453,265 244,299 247,26560,221 63,187

Transcripts

Exon 305 occurs in the following Titin transcripts (the number indicates the exon rank of exon 305 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
304 254 132 253 133 133 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Ig-like 106, Fibronectin type-III 34/35/36, Ig-like 107, Fibronectin type-III 37/38, Ig-like 108, Fibronectin type-III 39/40.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 97% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-PRO12SR01222c.60931C>Tp.Arg20311Xnonsense
STM 2015DCM-PRO10TM00933c.63025C>Tp.Arg21009Xnonsense
STM 2015DCM-REPLJR-II-1c.61495C>Tp.Arg20499*nonsense
STM 2015FHS26653c.62506C>Tp.R20836*nonsense
NEJM 2012DCM-AMEH-11c.61290T>Ap.Cys20430Xnonsense
NEJM 2012DCM-AMEW-11c.61876C>Tp.Arg20626Xnonsense
NEJM 2012DCM-AMDJ-21c.61495C>Tp.Arg20499Xnonsense
NEJM 2012DCM-CDNFDC142-05-0569c.61876C>Tp.Arg20626Xnonsense

Sequence

Size of Exon: 2967 bases           Ensembl ID: ENSE00002316585

TGCCTCCATCCGTGGAGCTAGATGTGAAATTAATTGAAGGTCTTGTGGTAAAGGCTGGAACCACAGTCAGATTCCCTGCTATTATAAGAGGTGTGCCTGTTCCTACTGCAAAGTGGACAA
CCGATGGGAGTGAGATTAAAACCGATGAGCACTACACAGTTGAAACAGACAACTTCTCATCAGTACTTACCATTAAGAACTGCTTAAGGAGAGACACTGGGGAATATCAAATCACAGTTT
CCAATGCAGCCGGTAGCAAAACAGTAGCCGTACATCTTACTGTTCTTGATGTTCCTGGGCCACCAACAGGTCCTATTAATATTCTGGATGTTACTCCTGAACACATGACTATCTCATGGC
AGCCACCTAAGGATGATGGAGGAAGCCCTGTGATAAATTATATTGTTGAGAAACAAGATACAAGGAAAGACACGTGGGGTGTTGTCTCTTCCGGAAGCAGTAAGACAAAGCTGAAAATCC
CACATCTGCAGAAGGGCTGTGAATATGTTTTCCGAGTTAGAGCAGAGAATAAGATAGGTGTTGGTCCTCCCCTTGACTCCACACCTACTGTTGCTAAGCATAAATTTAGTCCTCCGTCTC
CTCCTGGTAAACCAGTGGTTACTGACATTACTGAAAATGCAGCAACAGTGTCTTGGACCCTGCCAAAATCTGATGGTGGCAGTCCAATAACTGGCTACTATATGGAACGTCGAGAAGTAA
CTGGCAAATGGGTGAGGGTCAACAAAACACCTATCGCTGACCTGAAGTTCAGAGTGACTGGACTCTATGAAGGAAATACATATGAGTTTAGAGTTTTTGCTGAAAATCTTGCAGGACTAA
GCAAACCATCCCCAAGTTCTGATCCAATAAAAGCTTGCCGGCCCATCAAACCACCTGGACCACCTATTAATCCTAAACTGAAAGACAAGAGCAGAGAAACAGCTGATTTGGTGTGGACAA
AGCCTCTCAGTGATGGTGGTAGCCCCATTCTAGGATATGTAGTGGAATGTCAGAAACCTGGCACAGCACAATGGAACAGGATTAATAAAGATGAACTCATTAGGCAATGTGCCTTTAGGG
TACCTGGACTAATTGAAGGAAATGAGTACAGATTCCGTATAAAGGCAGCTAATATTGTAGGAGAGGGTGAGCCAAGAGAACTAGCAGAATCTGTGATTGCAAAAGATATCCTTCATCCTC
CAGAAGTAGAACTTGATGTTACTTGTCGTGATGTTATTACCGTGAGAGTAGGCCAAACTATCCGCATTCTAGCTCGAGTCAAAGGCAGACCTGAACCAGACATAACTTGGACTAAGGAAG
GCAAAGTATTGGTCCGAGAAAAGAGGGTGGACCTTATTCAGGATCTACCTCGTGTTGAGTTACAAATTAAAGAAGCTGTTAGAGCTGATCATGGCAAGTATATCATCTCAGCTAAGAACA
GCAGTGGACATGCCCAAGGTTCAGCCATCGTTAACGTCCTTGACAGACCTGGGCCTTGCCAGAATTTGAAGGTTACCAATGTAACCAAAGAGAACTGTACAATTTCTTGGGAAAACCCAC
TAGATAATGGTGGCTCAGAAATAACAAACTTCATAGTAGAATATCGCAAACCAAACCAGAAAGGCTGGTCAATTGTTGCATCAGATGTCACTAAACGATTAATCAAGGCCAACCTTTTAG
CCAACAATGAATACTATTTCCGAGTTTGTGCAGAGAATAAAGTAGGTGTTGGGCCAACCATCGAAACAAAAACTCCCATTCTGGCTATTAACCCTATTGACAGACCAGGTGAGCCTGAAA
ACCTTCACATTGCAGATAAAGGAAAGACATTTGTCTATCTAAAGTGGCGGAGGCCTGACTATGATGGTGGCAGTCCAAATCTGTCATATCATGTTGAGAGAAGGCTTAAGGGCTCCGATG
ACTGGGAAAGAGTGCATAAAGGAAGCATTAAAGAAACTCACTACATGGTTGACAGATGTGTTGAAAACCAGATTTATGAGTTCAGAGTGCAAACAAAGAATGAAGGTGGGGAAAGTGACT
GGGTGAAGACAGAGGAAGTTGTTGTGAAAGAAGACTTACAAAAACCAGTACTTGATCTGAAATTAAGTGGGGTCCTAACTGTCAAAGCAGGGGACACCATTAGGCTTGAGGCAGGGGTTA
GAGGCAAACCATTCCCAGAAGTTGCATGGACCAAGGACAAAGACGCTACAGACTTAACAAGATCACCAAGGGTCAAGATTGATACCCGTGCTGATTCATCTAAATTTTCTCTTACTAAAG
CAAAGCGAAGTGATGGGGGTAAATATGTAGTTACGGCAACTAACACGGCTGGCAGTTTTGTGGCCTATGCCACTGTCAATGTTTTAGATAAGCCTGGTCCTGTGAGAAATCTGAAAATTG
TTGATGTGTCCAGTGATAGGTGTACTGTTTGCTGGGATCCACCAGAAGATGATGGTGGCTGTGAAATCCAAAATTATATTCTAGAAAAATGTGAGACAAAGCGAATGGTTTGGTCTACCT
ATTCTGCTACTGTCTTGACACCTGGTACTACAGTAACACGTCTCATAGAAGGAAATGAATATATTTTCAGAGTCCGTGCAGAAAATAAAATAGGCACAGGGCCTCCAACAGAAAGTAAAC
CAGTCATAGCCAAAACCAAGTATGATAAACCTGGTCGCCCTGATCCCCCAGAAGTCACTAAAGTAAGCAAAGAAGAGATGACTGTGGTTTGGAATCCACCTGAATATGATGGTGGAAAGT
CTATAACTGGATACTTTTTGGAGAAAAAGGAAAAGCATTCAACACGATGGGTCCCTGTCAACAAGAGTGCAATCCCTGAGAGACGTATGAAAGTACAGAATCTCCTCCCAGACCATGAAT
ATCAGTTCCGTGTCAAGGCAGAAAATGAAATTGGAATTGGAGAACCAAGCTTGCCTTCAAGACCGGTGGTGGCAAAAGACCCCATAG

ATGC = coding sequence, ATGC = non-coding sequence