Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 327

Details for Exon 327 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 327 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,441,143 179,424,038 259,387 276,49269,716 86,821

Transcripts

Exon 327 occurs in the following Titin transcripts (the number indicates the exon rank of exon 327 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
326 276 154 275 155 155 -

Functional Data

Region: This exon occurs in the A-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Fibronectin type-III 57, Ig-like 114, Fibronectin type-III 58/59, Ig-like 115, Fibronectin type-III 60/61/62, Ig-like 116, Fibronectin type-III 63/64/65, Ig-like 117, Fibronectin type-III 66/67, Ig-like 118, Fibronectin type-III 68/69/70, Ig-like 119, Fibronectin type-III 71/72/73, Ig-like 120, Fibronectin type-III 74/75, Ig-like 121, Fibronectin type-III 76/77/78, Ig-like 122, Fibronectin type-III 79/80/81, Ig-like 123, Fibronectin type-III 82/83, Ig-like 124, Fibronectin type-III 84/85/86, Ig-like 125, Fibronectin type-III 87/88/89, Ig-like 126, Fibronectin type-III 90/91, Ig-like 127, Fibronectin type-III 92/93/94, Ig-like 128, Fibronectin type-III 96/96/97, Ig-like 129, Fibronectin type-III 98.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 95% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
RECOVERY 2016DCM-REC20JJ01199c.71326G>Tp.E23776Xnonsense
RECOVERY 2016DCM-REC20SB01532c.76383_76386delTAATp.Asn25462LysfsTer4frameshift
RECOVERY 2016DCM-REC20DH01701c.81518delCp.Pro27173HisfsTer17frameshift
RECOVERY 2016DCM-NON-REC20BP01200c.69976G>Tp.E23326Xnonsense
PAED 2016ADOLESCENTUK-16c.69976G>Tp.E23326Xnonsense
PAED 2016ADOLESCENTUK-27c.71326G>Tp.E23776Xnonsense
PAED 2016ADOLESCENTAV-IV-2c.78095_78098delAAAGp.R26032TfsX41frameshift
PAED 2016ADOLESCENTBR-IV-1c.78991C>Tp.R26331Xnonsense
STM 2015DCM-PRO10CP00605c.82513delAp.Ile27505PhefsX20frameshift
STM 2015DCM-PRO10PP00465c.85090C>Tp.Arg28364Xnonsense
STM 2015DCM-PRO12MH00114c.86640delCp.His28881ThrfsX2frameshift
STM 2015DCM-PRO12JL01327c.74306dupAp.Asn24769LysfsX2frameshift
STM 2015DCM-PRO10BK01803c.78184G>Tp.Glu26062Xnonsense
STM 2015DCM-PRO10JC00262c.78507delTp.Gly26170ValfsX3frameshift
STM 2015DCM-PRO10DM00077c.81262_81269delCAGATGCTp.Gln27088CysfsX5frameshift
STM 2015DCM-PRO10PP00413c.81262_81269delCAGATGCTp.Gln27088CysfsX5frameshift
STM 2015DCM-PRO12NP00167c.81321C>Gp.Tyr27107Xnonsense
STM 2015DCM-ES20CW01447c.69843_69843delAp.K23281fsframeshift
STM 2015DCM-ES20HS01530c.70791_70791delAp.E23597fsframeshift
STM 2015DCM-ES20FG01148c.74338C>Tp.Arg24780*nonsense
STM 2015DCM-ES20SF01123c.76116_76117insAp.Asn25372fsframeshift
STM 2015DCM-ES20SB01532c.76383_76386delTAATp.Asn25462fsframeshift
STM 2015DCM-ES20DH01701c.81518delCp.Pro27173fsframeshift
STM 2015DCM-ES20LN01500c.86459_86460delCTp.S28820fsframeshift
STM 2015DCM-REPLJM-II-4c.69877G>Tp.Gly23293*nonsense
STM 2015DCM-REPLLL-III-1c.73109G>Ap.Trp24370*nonsense
STM 2015DCM-REPLDI-II-6c.74883_74884insAACAp.Pro24962fsframeshift
STM 2015DCM-REPLCT-II-2c.76115dupAp.Asn25372fsframeshift
STM 2015DCM-REPLR-IV-2c.76115dupAp.Asn25372fsframeshift
STM 2015DCM-REPLAV-IV-2c.78095_78098delGAAAp.Arg26032fsframeshift
STM 2015DCM-REPLBR-IV-1c.78991C>Tp.Arg26331*nonsense
STM 2015DCM-REPLEA-II-7c.78991C>Tp.Arg26331*nonsense
STM 2015DCM-REPLLX-III-9c.79684C>Tp.Arg26562*nonsense
STM 2015DCM-REPLIT-II-2c.83515C>Tp.Arg27839*nonsense
STM 2015DCM-REPLLT-II-1c.84376C>Tp.Gln28126*nonsense
STM 2015FHS9484c.80635C>Tp.Q26879*nonsense
STM 2015JHSJ578580c.75123T>Ap.Y25041*nonsense
STM 2015JHSJ545511c.85008_85011delTAGTp.V28336fsframeshift
LMM 2014ALL-CASES117c.73845delAp.Glu24615AspfsX9frameshift
LMM 2014ALL-CASES111c.77421_77422insCp.Ser25808GlnfsX19frameshift
LMM 2014ALL-CASES108c.86821+2T>Aessential splice site
PPCM 2014PPCMNL1-II:3c.82117C>Tp.Arg27373*nonsense
PPCM 2014PPCMNL6-II:3c.86171_86174dupAAAGp.Asn28726Lysfs*3frameshift
PPCM 2014PPCMNL10-II:6c.71867_71876delGAGTTCTGGAap.Arg23956Thrfs*9aframeshift
PPCM 2014PPCMNL11-III:1c.81949dupAp.Ser27317Lysfs*10frameshift
NEJM 2012DCM-AHFA-57c.77101_77102insTp.Gln25700fsframeshift
NEJM 2012DCM-AMEK-111c.72668delTp.Pro24223fsframeshift
NEJM 2012DCM-AMGW-11c.85768C>Tp.Arg28590Xnonsense
NEJM 2012DCM-AMHG-23c.71980_71986delGCATATGinsTAp.Ala23994fsframeshift
NEJM 2012DCM-AMID-1c.81988C>Tp.Gln27330Xnonsense
NEJM 2012DCM-AMIP-13c.86363G>Ap.Trp28788Xnonsense
NEJM 2012DCM-ASS-287-15c.77646_77662delinsAGAp.Ser25882fsframeshift
NEJM 2012DCM-ASS-725c.81988C>Tp.Gln27330Xnonsense
NEJM 2012DCM-AMIA-1c.86821+2T>Aessential splice site
NEJM 2012DCM-B UK-H2c.69848delTp.Lys23281fsframeshift
NEJM 2012DCM-B UK-C8c.70790delAp.Glu23597fsframeshift
NEJM 2012DCM-B UK-C6c.86459_86460delCTp.Ser28820fsframeshift
NEJM 2012DCM-CDNFDC081-02-1564c.85969A>Tp.Lys28657Xnonsense
NEJM 2012DCM-CDNFDC088-02-1900c.84819G>Ap.Trp28273Xnonsense
NEJM 2012ControlsA-15c.76697_76698delTTp.Leu25566fsframeshift

The shaded variants are from a cohort (DCM-B of the 2012 NEJM study) that was also included in the 2015 STM study (DCM-ES cohort) and therefore represent redundant mutations.

Sequence

Size of Exon: 17106 bases           Ensembl ID: ENSE00002304613

ATCCTCCAGGACCACCTTCAAATCCGCATGTCACTGATACTACCAAGAAATCTGCTTCTTTGGCATGGGGCAAGCCTCATTATGATGGTGGACTTGAAATCACTGGCTATGTCGTGGAGC
ATCAAAAAGTAGGAGACGAGGCCTGGATAAAAGATACCACAGGAACCGCCCTCAGAATCACTCAGTTCGTTGTTCCTGATCTTCAGACTAAAGAAAAATACAACTTCAGAATCAGTGCCA
TCAACGATGCAGGTGTTGGGGAGCCAGCGGTGATTCCAGATGTTGAAATCGTAGAACGGGAGATGGCTCCTGATTTTGAACTAGATGCCGAGCTTCGAAGAACACTTGTTGTTAGAGCAG
GACTCAGTATTAGGATATTTGTGCCAATTAAAGGTCGTCCTGCTCCTGAAGTGACATGGACCAAAGATAACATCAACCTGAAAAACCGAGCCAACATTGAAAATACGGAATCATTTACTC
TTCTGATTATCCCAGAATGTAACAGATATGATACCGGTAAATTTGTCATGACCATTGAAAACCCGGCTGGGAAGAAAAGTGGCTTTGTGAACGTCAGAGTCTTGGACACGCCAGGCCCAG
TCCTCAACCTGCGGCCTACAGACATCACAAAGGACAGTGTCACCCTGCACTGGGACCTCCCTCTGATAGATGGAGGCTCACGTATAACAAACTACATTGTAGAGAAACGTGAAGCAACAC
GGAAATCTTATTCCACAGCCACCACTAAGTGCCATAAATGCACATATAAAGTTACCGGCTTGTCTGAAGGGTGTGAATATTTCTTCAGAGTGATGGCAGAGAATGAATATGGAATTGGTG
AGCCAACAGAAACTACAGAGCCCGTAAAAGCCTCTGAAGCACCATCTCCACCAGACAGCCTTAACATCATGGACATAACTAAGAGCACCGTCAGCCTGGCATGGCCTAAGCCCAAACACG
ATGGTGGCAGCAAGATCACTGGCTATGTGATTGAAGCCCAAAGAAAAGGCTCTGACCAGTGGACCCACATCACAACCGTGAAAGGGTTAGAATGTGTTGTGAGGAATCTAACTGAAGGAG
AGGAATATACCTTCCAAGTGATGGCAGTGAACAGCGCGGGGAGAAGTGCCCCTAGAGAAAGCAGACCCGTCATTGTCAAGGAGCAGACAATGCTTCCAGAGCTGGATCTCCGTGGCATCT
ATCAGAAACTGGTCATTGCCAAAGCTGGTGACAACATCAAAGTTGAAATTCCAGTGCTCGGTCGACCGAAGCCCACAGTGACATGGAAAAAAGGAGACCAAATTCTTAAACAGACACAGA
GAGTTAATTTTGAAACCACAGCGACTTCAACCATTTTAAATATCAATGAGTGTGTCAGAAGTGATAGTGGGCCCTATCCATTAACAGCAAGGAACATTGTAGGAGAGGTTGGTGATGTCA
TCACCATTCAAGTCCATGATATCCCAGGGCCACCTACTGGACCAATCAAATTTGATGAAGTTTCATCTGATTTTGTAACCTTCTCTTGGGACCCACCTGAGAACGATGGTGGTGTACCAA
TAAGCAACTATGTAGTGGAAATGCGGCAGACTGACAGTACTACCTGGGTTGAGTTAGCAACCACCGTTATACGTACTACCTATAAAGCCACCCGCCTTACTACTGGATTAGAGTATCAGT
TCCGTGTAAAAGCTCAGAATAGATATGGAGTTGGACCAGGCATCACATCAGCATGCATAGTTGCCAACTATCCATTTAAGGTTCCTGGACCTCCTGGTACCCCTCAGGTAACTGCAGTTA
CCAAGGATTCAATGACAATTAGCTGGCATGAGCCACTTTCTGATGGTGGAAGCCCCATTTTAGGATATCATGTTGAAAGAAAAGAACGAAATGGTATTCTCTGGCAGACTGTGAGCAAAG
CTTTAGTACCAGGCAACATTTTCAAATCAAGTGGACTTACAGATGGTATTGCTTATGAGTTCCGGGTGATTGCAGAAAACATGGCAGGCAAAAGTAAGCCAAGCAAGCCATCAGAACCTA
TGTTGGCTCTGGATCCCATTGACCCACCTGGAAAACCAGTACCTCTAAATATTACAAGACACACAGTAACACTTAAATGGGCTAAGCCTGAATATACTGGGGGCTTTAAAATTACCAGTT
ATATCGTTGAAAAGAGAGACCTTCCTAATGGACGGTGGCTGAAGGCCAACTTCAGCAACATTTTGGAGAATGAATTTACAGTCAGTGGCCTAACAGAAGATGCTGCATATGAATTCCGTG
TGATCGCCAAAAATGCTGCAGGTGCCATCAGTCCACCATCTGAGCCATCTGATGCTATCACTTGCAGGGATGATGTTGAGGCACCAAAGATAAAGGTGGATGTTAAATTTAAGGACACGG
TTATATTAAAAGCAGGTGAAGCATTCAGACTGGAAGCTGATGTTTCAGGCCGCCCACCTCCAACAATGGAATGGAGCAAAGATGGAAAAGAGCTGGAAGGCACAGCAAAGTTAGAAATAA
AAATTGCAGATTTCTCTACTAATCTGGTAAACAAAGATTCAACAAGAAGGGATAGTGGTGCCTATACCCTTACAGCGACTAATCCTGGTGGCTTTGCTAAACACATTTTCAATGTCAAAG
TTCTTGACAGACCAGGCCCACCTGAAGGACCTTTGGCTGTAACTGAAGTGACATCAGAAAAGTGTGTACTATCATGGTTCCCTCCACTGGATGATGGAGGTGCCAAAATTGATCATTACA
TAGTACAGAAACGTGAAACCAGCAGATTGGCATGGACAAATGTAGCCTCAGAAGTCCAAGTAACAAAGCTAAAGGTCACTAAACTCTTGAAAGGCAATGAATACATATTCCGTGTCATGG
CTGTAAATAAATATGGAGTGGGAGAGCCACTGGAATCAGAGCCTGTGCTTGCAGTGAATCCTTATGGACCCCCTGATCCGCCCAAAAACCCTGAAGTGACAACTATTACTAAAGATTCGA
TGGTTGTCTGCTGGGGACATCCTGATTCTGATGGTGGAAGTGAAATCATCAATTATATTGTGGAACGGCGTGATAAAGCTGGCCAACGCTGGATTAAATGCAACAAAAAAACTCTTACTG
ATTTAAGATATAAAGTGTCTGGACTGACAGAAGGACATGAATATGAGTTCAGGATTATGGCTGAAAATGCTGCTGGAATTAGTGCACCAAGTCCTACCAGTCCATTTTACAAGGCTTGTG
ACACTGTGTTTAAACCTGGACCACCAGGTAACCCACGTGTTCTGGATACAAGCAGATCATCCATTTCAATCGCTTGGAATAAACCTATCTATGATGGTGGTTCAGAAATCACTGGGTATA
TGGTTGAGATTGCCCTGCCAGAGGAAGATGAATGGCAGATTGTCACTCCACCAGCAGGACTCAAGGCAACTTCGTATACTATCACTGGCCTCACAGAGAATCAGGAATATAAGATCCGCA
TCTATGCCATGAATTCCGAAGGACTTGGGGAACCTGCCCTTGTTCCTGGAACTCCAAAGGCTGAAGACAGAATGCTGCCTCCAGAAATTGAACTGGATGCTGACCTGCGCAAAGTTGTTA
CTATAAGGGCCTGCTGCACCCTGAGACTTTTTGTTCCCATCAAAGGAAGGCCTGCACCTGAGGTGAAGTGGGCCCGGGACCATGGAGAATCTTTAGATAAAGCTAGCATCGAATCCACAA
GCTCTTACACCCTGCTTATTGTTGGAAATGTAAACAGATTTGACAGTGGCAAATATATACTAACTGTAGAAAATAGTTCAGGCAGCAAGTCTGCATTTGTCAATGTTAGAGTTCTCGATA
CACCAGGCCCCCCACAGGATCTGAAGGTAAAAGAGGTCACTAAGACATCTGTCACACTCACATGGGACCCACCTCTCCTTGATGGAGGTTCAAAAATCAAGAACTATATTGTTGAAAAGC
GGGAATCAACAAGAAAAGCATATTCAACTGTTGCAACAAACTGCCACAAGACTTCCTGGAAGGTAGACCAGCTTCAAGAAGGCTGTAGCTACTATTTCAGGGTTCTCGCAGAAAATGAAT
ATGGCATTGGGCTGCCTGCTGAAACCGCAGAATCTGTGAAAGCATCAGAACGACCTCTTCCTCCAGGAAAAATAACTTTGATGGATGTCACAAGAAATAGTGTGTCACTCTCTTGGGAGA
AACCAGAGCATGATGGAGGCAGCCGAATTCTAGGCTACATTGTGGAGATGCAGACCAAAGGCAGTGACAAATGGGCCACGTGTGCCACAGTCAAGGTCACTGAAGCCACTATCACTGGAT
TAATTCAGGGTGAAGAATACTCTTTCCGTGTTTCAGCTCAGAATGAAAAGGGCATCAGTGATCCTAGACAACTGAGTGTGCCAGTGATCGCCAAAGATCTTGTCATTCCACCAGCCTTCA
AACTCCTGTTCAATACTTTCACTGTACTGGCAGGTGAAGACCTAAAAGTTGATGTTCCATTCATTGGCCGCCCTACCCCAGCTGTAACCTGGCATAAAGATAATGTACCACTGAAGCAGA
CAACTAGAGTAAATGCAGAGAGCACAGAAAATAATTCACTACTGACAATAAAGGACGCCTGCCGAGAAGATGTTGGCCATTATGTGGTTAAACTGACTAACTCAGCTGGTGAAGCTATTG
AAACCCTTAATGTTATCGTTCTTGACAAACCAGGGCCTCCAACTGGACCAGTTAAAATGGATGAAGTGACAGCTGATAGTATTACTCTTTCCTGGGGCCCACCCAAGTATGATGGTGGAA
GTTCTATCAATAATTACATTGTTGAGAAACGGGACACTTCCACAACCACCTGGCAAATTGTATCAGCTACAGTTGCAAGGACAACAATAAAGGCTTGCAGACTGAAGACTGGATGTGAAT
ATCAGTTTAGAATTGCAGCTGAAAACAGATATGGGAAGAGTACCTACCTCAATTCAGAGCCTACTGTAGCCCAATATCCATTCAAAGTTCCTGGTCCTCCTGGCACTCCAGTTGTCACAC
TGTCCTCCAGGGACAGCATGGAAGTACAATGGAATGAGCCAATCAGTGATGGAGGAAGTAGAGTCATTGGCTATCATCTAGAACGCAAGGAAAGAAATAGCATCCTCTGGGTTAAGTTGA
ATAAAACACCTATTCCTCAAACCAAGTTTAAGACAACTGGCCTTGAAGAAGGTGTTGAATATGAATTTAGAGTCTCTGCAGAGAACATCGTGGGCATTGGCAAGCCGAGTAAAGTATCAG
AATGTTATGTGGCTCGTGACCCATGTGATCCACCAGGACGGCCAGAGGCAATCATTGTCACAAGGAATTCTGTGACTCTTCAGTGGAAGAAACCCACCTATGACGGTGGAAGCAAGATCA
CTGGTTATATTGTTGAGAAGAAAGAATTACCTGAGGGCCGTTGGATGAAAGCCAGTTTTACAAATATTATTGACACTCATTTTGAAGTAACTGGCCTAGTTGAAGATCACAGATATGAGT
TCCGGGTTATAGCCCGAAATGCCGCAGGAGTGTTTAGTGAGCCTTCAGAAAGCACAGGAGCAATAACAGCTAGAGATGAGGTAGATCCACCACGAATAAGTATGGATCCAAAATACAAAG
ACACAATCGTGGTTCATGCTGGTGAATCATTCAAGGTTGATGCAGATATTTATGGCAAACCAATACCAACCATTCAGTGGATAAAAGGTGATCAGGAGCTTTCAAACACAGCTCGATTAG
AAATAAAGAGCACCGACTTTGCCACCAGTCTCAGTGTAAAAGATGCAGTACGTGTCGACAGTGGAAATTACATACTGAAGGCCAAAAATGTTGCAGGAGAAAGATCAGTTACTGTGAATG
TCAAGGTTCTTGACAGACCAGGGCCACCTGAAGGACCTGTTGTTATCTCAGGAGTTACAGCAGAAAAATGCACACTAGCTTGGAAACCCCCACTTCAGGATGGTGGGAGTGACATCATAA
ATTATATTGTGGAAAGGAGAGAAACCAGCCGCTTAGTTTGGACTGTGGTTGATGCCAATGTGCAGACTCTCAGCTGCAAGGTTACTAAGCTTCTTGAAGGCAATGAATATACTTTCCGTA
TAATGGCAGTAAACAAATATGGTGTTGGTGAACCTCTTGAATCTGAGCCAGTAGTTGCCAAGAATCCATTTGTAGTACCAGATGCACCAAAAGCTCCAGAAGTCACAACAGTGACCAAGG
ACTCAATGATTGTTGTATGGGAAAGACCAGCATCTGATGGTGGTAGTGAAATTCTTGGATATGTTCTTGAGAAACGGGATAAAGAAGGCATTAGATGGACAAGATGCCATAAGCGTCTGA
TTGGAGAGTTGCGCCTGAGAGTAACTGGACTCATAGAAAATCACGATTATGAGTTCAGAGTTTCTGCTGAGAATGCTGCTGGACTTAGTGAACCAAGCCCTCCTTCTGCTTACCAAAAGG
CTTGTGATCCTATTTATAAACCAGGACCCCCAAACAACCCCAAAGTCATAGACATAACCAGATCTTCAGTATTCCTTTCTTGGAGCAAACCAATATATGATGGTGGCTGTGAAATTCAAG
GATACATTGTTGAAAAATGTGATGTGAGTGTTGGTGAATGGACAATGTGCACTCCACCAACAGGAATTAATAAAACAAACATAGAAGTAGAGAAGCTGTTGGAAAAGCATGAATACAACT
TCCGTATCTGTGCTATTAATAAAGCTGGAGTTGGAGAACATGCTGACGTCCCTGGACCTATTATAGTTGAAGAAAAATTAGAAGCACCAGACATTGATCTTGACCTAGAACTAAGGAAAA
TCATAAATATAAGGGCAGGTGGCTCCTTAAGGTTATTTGTTCCTATAAAAGGTCGTCCTACACCAGAAGTTAAATGGGGAAAGGTGGATGGTGAAATCCGAGATGCAGCTATAATTGATG
TCACTAGCAGTTTCACCTCTCTTGTTCTTGACAATGTCAACCGATATGATAGTGGAAAATATACGCTTACATTAGAAAACAGCAGTGGAACAAAGTCTGCCTTTGTTACTGTGAGAGTTC
TGGACACGCCAAGTCCACCTGTTAACCTGAAAGTCACAGAAATCACCAAAGACTCAGTATCAATTACATGGGAACCTCCTTTGTTGGATGGGGGATCCAAAATAAAAAATTACATTGTTG
AGAAACGTGAAGCCACAAGAAAATCATATGCTGCTGTTGTAACTAACTGCCATAAGAATTCTTGGAAAATCGATCAGCTCCAAGAAGGTTGCAGTTATTACTTTAGAGTCACAGCTGAGA
ATGAGTATGGTATTGGCCTTCCTGCCCAGACTGCTGATCCAATTAAGGTTGCAGAAGTGCCACAACCTCCTGGAAAAATAACTGTGGATGATGTCACCAGAAACAGTGTCTCTCTGAGTT
GGACAAAACCTGAACATGATGGTGGCAGTAAAATCATTCAGTATATTGTGGAAATGCAAGCTAAACACAGTGAGAAATGGTCAGAGTGTGCTCGAGTAAAGTCTCTTCAGGCAGTAATTA
CCAACCTAACTCAAGGGGAAGAATATCTTTTTAGAGTTGTTGCTGTAAATGAAAAGGGGAGAAGTGATCCTCGGTCCCTTGCAGTTCCAATAGTTGCCAAAGATCTGGTAATTGAGCCAG
ATGTAAAACCTGCATTCAGTAGTTACAGTGTACAGGTTGGCCAAGATTTGAAAATAGAAGTGCCAATTTCTGGACGTCCTAAGCCAACCATTACCTGGACTAAAGATGGTCTCCCACTGA
AGCAGACCACAAGAATCAATGTTACCGATTCACTGGATCTCACCACACTCAGTATTAAAGAAACTCATAAGGATGATGGTGGACAATATGGAATCACAGTTGCCAATGTTGTTGGTCAGA
AGACAGCATCCATCGAAATTGTAACTCTAGATAAACCTGATCCTCCAAAAGGACCTGTTAAATTTGATGACGTCAGTGCTGAAAGTATTACATTATCTTGGAACCCTCCATTATATACAG
GGGGCTGCCAAATCACCAACTACATTGTTCAGAAAAGAGATACAACCACCACAGTATGGGATGTTGTTTCTGCTACTGTTGCTAGAACTACACTCAAAGTGACCAAACTGAAAACTGGTA
CAGAATACCAATTTAGAATATTTGCCGAAAACAGATATGGACAAAGCTTTGCCTTAGAGTCTGATCCAATTGTAGCTCAATATCCCTACAAAGAACCAGGCCCTCCAGGTACACCATTTG
CCACAGCCATTTCCAAAGACTCCATGGTCATACAGTGGCATGAACCAGTCAACAATGGTGGAAGCCCCGTCATAGGTTACCACCTGGAGAGAAAAGAAAGAAACAGTATTTTGTGGACAA
AGGTCAACAAAACTATTATTCATGACACCCAATTCAAAGCACAGAATCTTGAAGAAGGCATTGAATATGAATTCAGAGTGTATGCTGAAAATATTGTTGGTGTAGGCAAAGCAAGCAAGA
ATTCTGAATGCTATGTAGCCAGAGATCCCTGTGACCCACCAGGAACCCCAGAACCAATAATGGTTAAAAGAAATGAAATCACTTTACAGTGGACCAAACCTGTGTATGATGGTGGAAGTA
TGATTACAGGCTACATTGTAGAGAAACGTGATTTGCCTGATGGTCGTTGGATGAAAGCTAGCTTTACAAATGTCATTGAAACTCAATTTACTGTGTCAGGTCTTACTGAAGATCAAAGAT
ATGAATTCAGAGTCATTGCAAAGAATGCAGCTGGTGCAATAAGTAAACCCTCTGACAGTACTGGACCAATAACTGCCAAGGATGAGGTTGAACTCCCAAGAATTTCAATGGATCCAAAAT
TCAGAGACACAATTGTGGTAAATGCTGGAGAAACATTCAGACTTGAGGCTGATGTCCATGGAAAGCCCCTACCTACCATTGAGTGGTTAAGAGGAGATAAGGAAATTGAAGAATCTGCTA
GATGTGAAATAAAGAACACAGATTTCAAGGCTTTACTTATTGTAAAAGATGCAATTAGAATTGATGGTGGGCAGTATATTTTAAGAGCTTCCAATGTTGCAGGTTCTAAGTCATTCCCAG
TAAATGTAAAAGTATTAGATAGACCAGGACCTCCAGAAGGGCCAGTCCAGGTTACTGGAGTCACTTCTGAAAAATGCTCTTTAACATGGTCTCCACCACTTCAAGATGGTGGCAGTGACA
TTTCTCACTATGTTGTTGAAAAGCGAGAAACCAGTCGACTTGCCTGGACTGTTGTTGCTTCAGAAGTTGTGACCAATTCTCTGAAAGTTACCAAACTCTTAGAAGGTAATGAATATGTTT
TCCGTATAATGGCTGTCAACAAATATGGTGTTGGAGAGCCTTTGGAATCTGCACCAGTACTAATGAAAAATCCATTTGTGCTTCCTGGACCACCAAAAAGCTTGGAAGTCACAAATATTG
CCAAAGACTCCATGACCGTCTGTTGGAACCGTCCAGATAGTGATGGTGGAAGTGAGATTATTGGTTACATTGTAGAGAAAAGAGACAGAAGTGGCATTCGATGGATAAAATGTAATAAAC
GCCGCATTACAGATTTGCGTCTAAGAGTGACAGGATTAACAGAAGATCATGAGTATGAATTCAGGGTCTCTGCAGAAAATGCTGCTGGAGTTGGGGAACCAAGTCCAGCTACAGTTTATT
ATAAAGCCTGTGATCCTGTGTTCAAACCTGGCCCACCTACCAATGCACACATTGTAGACACCACTAAAAATTCAATCACACTTGCCTGGGGTAAACCCATCTATGATGGCGGCAGTGAGA
TCTTGGGATATGTAGTAGAAATCTGTAAAGCAGATGAAGAAGAATGGCAAATAGTTACTCCACAGACTGGCCTGAGAGTCACTCGATTTGAAATTTCAAAACTCACTGAACACCAAGAGT
ATAAAATACGAGTCTGTGCCCTCAACAAAGTTGGTTTAGGTGAGGCTACATCAGTTCCTGGTACTGTGAAACCAGAAGATAAACTTGAAGCACCTGAACTTGACCTTGACTCCGAATTAA
GAAAAGGAATTGTTGTAAGAGCTGGTGGATCTGCCAGAATTCACATTCCATTCAAAGGTCGTCCAACGCCTGAGATCACTTGGTCTCGAGAGGAAGGTGAATTCACAGATAAGGTCCAAA
TTGAAAAGGGAGTAAACTATACCCAACTATCAATAGATAACTGTGATAGAAATGATGCTGGAAAATACATTCTTAAGTTGGAAAACAGCAGTGGATCAAAGTCTGCTTTTGTAACTGTGA
AAGTTCTTGACACTCCAGGACCACCACAGAATTTGGCAGTCAAAGAAGTGAGAAAAGATTCTGCCTTCCTGGTATGGGAGCCACCCATCATTGATGGAGGGGCAAAGGTCAAGAACTATG
TGATTGACAAACGTGAGTCAACCAGAAAAGCGTATGCTAATGTGAGTAGTAAATGCAGCAAAACAAGTTTTAAAGTGGAAAACCTTACAGAAGGAGCCATTTATTACTTCAGAGTCATGG
CTGAAAATGAATTTGGAGTTGGTGTTCCAGTGGAAACTGTTGATGCCGTGAAAGCTGCTGAACCTCCTTCCCCACCAGGAAAGGTTACACTCACTGATGTGTCCCAGACCAGTGCATCAC
TTATGTGGGAGAAACCTGAACATGATGGCGGTAGCAGAGTCCTGGGGTACGTTGTTGAAATGCAGCCCAAAGGAACTGAAAAATGGAGCATTGTGGCTGAATCCAAAGTCTGTAATGCAG
TTGTTACTGGTTTGAGTTCTGGACAAGAATATCAGTTCCGTGTCAAGGCTTATAATGAGAAAGGAAAAAGCGATCCAAGAGTGTTGGGTGTTCCTGTCATAGCCAAGGACTTGACTATAC
AGCCTAGTTTAAAGTTACCATTTAACACATATAGTATCCAAGCTGGAGAAGATCTTAAAATAGAAATTCCAGTTATAGGCCGACCAAGACCTAACATTTCTTGGGTCAAAGATGGTGAGC
CTCTTAAACAGACAACAAGAGTAAACGTTGAAGAAACAGCTACCTCAACTGTTTTGCACATTAAAGAAGGTAACAAAGATGACTTTGGAAAATACACCGTAACGGCAACAAATAGTGCAG
GCACAGCAACAGAAAATCTCAGTGTTATCGTTTTAGAAAAGCCTGGACCTCCAGTTGGCCCAGTTCGGTTTGATGAAGTTAGTGCAGACTTTGTAGTCATATCTTGGGAACCTCCAGCCT
ATACTGGTGGCTGCCAAATAAGCAACTACATTGTAGAGAAGCGAGATACAACCACCACCACTTGGCACATGGTATCAGCAACAGTTGCAAGAACAACAATTAAAATAACCAAACTGAAAA
CAGGCACGGAGTACCAGTTTAGAATTTTTGCTGAAAACAGGTATGGAAAAAGTGCCCCACTGGATTCTAAGGCAGTTATTGTACAATATCCATTTAAAGAACCTGGACCACCTGGAACTC
CTTTTGTGACATCAATCTCAAAAGATCAGATGCTTGTGCAATGGCATGAGCCAGTGAATGATGGAGGCACCAAAATTATTGGCTACCATCTTGAACAGAAAGAAAAGAACAGTATTTTAT
GGGTCAAGTTAAATAAGACCCCCATTCAGGACACCAAATTCAAAACAACTGGGCTTGATGAGGGCCTTGAGTATGAGTTCAAAGTTTCTGCTGAAAATATTGTTGGCATTGGCAAGCCTA
GCAAAGTGTCAGAATGCTTTGTTGCTCGTGATCCATGTGACCCACCTGGTCGCCCTGAAGCCATTGTTATTACAAGAAACAATGTCACACTGAAATGGAAGAAACCTGCCTATGATGGTG
GTAGCAAAATAACAGGTTATATTGTAGAAAAGAAAGATCTACCTGATGGCCGCTGGATGAAAGCCAGCTTTACCAACGTATTAGAAACTGAATTTACAGTGAGTGGACTTGTAGAAGACC
AAAGATATGAATTTAGAGTAATTGCAAGAAATGCAGCTGGAAACTTTAGTGAACCATCTGATAGTAGTGGTGCCATTACTGCAAGAGATGAAATTGATGCACCAAATGCCTCTCTGGATC
CAAAATATAAAGATGTCATCGTTGTTCATGCAGGAGAGACTTTTGTTCTTGAAGCCGACATCCGTGGCAAACCTATACCTGATGTTGTTTGGTCAAAAGATGGAAAAGAACTTGAAGAAA
CAGCTGCTAGAATGGAAATTAAATCTACTATTCAGAAAACAACTCTTGTTGTCAAAGACTGTATACGGACTGATGGAGGACAATATATTCTGAAACTCAGCAATGTTGGTGGTACAAAGT
CTATACCCATCACTGTAAAGGTACTTGACAGGCCAGGGCCTCCTGAAGGGCCTCTGAAAGTTACTGGAGTTACTGCGGAAAAATGTTACCTGGCATGGAACCCACCTTTGCAAGATGGTG
GTGCTAATATTTCACATTACATCATTGAAAAGAGGGAGACAAGCCGACTCTCTTGGACCCAGGTTTCAACTGAGGTACAGGCCCTTAACTACAAAGTTACTAAACTTCTTCCTGGTAATG
AGTACATTTTCCGTGTCATGGCTGTGAATAAATATGGAATTGGAGAGCCCTTGGAATCTGGGCCTGTTACGGCCTGTAATCCTTATAAGCCACCAGGTCCTCCCTCAACACCTGAAGTCT
CAGCAATCACCAAAGATTCTATGGTAGTAACATGGGCACGCCCAGTAGACGACGGAGGTACCGAAATTGAGGGCTACATTCTTGAAAAACGAGATAAGGAAGGCGTTAGATGGACCAAGT
GCAACAAGAAAACATTAACGGATCTGCGGCTCAGGGTAACTGGTCTTACCGAAGGCCATTCCTATGAATTCAGAGTTGCTGCTGAAAATGCAGCTGGTGTGGGAGAACCTAGTGAGCCAT
CTGTTTTCTACCGTGCGTGTGATGCCTTGTATCCACCAGGTCCCCCAAGCAATCCAAAAGTGACGGACACTTCCAGATCTTCTGTCTCCCTGGCATGGAGTAAGCCAATTTATGATGGTG
GCGCACCTGTTAAAGGCTATGTTGTAGAGGTCAAAGAAGCTGCTGCGGATGAATGGACAACCTGCACTCCACCAACAGGATTACAAGGAAAGCAGTTCACAGTGACCAAGCTTAAAGAAA
ACACTGAATATAACTTCCGTATTTGTGCCATCAATTCTGAAGGTGTAGGTGAACCTGCAACTCTACCTGGCTCAGTGGTTGCTCAGGAGAGGATAGAGCCACCAGAAATAGAACTCGATG
CTGATCTCAGAAAGGTGGTCGTTCTGCGTGCAAGTGCTACTTTACGCTTATTTGTCACTATCAAAGGTCGACCAGAACCCGAAGTTAAATGGGAAAAGGCAGAAGGCATTCTCACTGACA
GGGCTCAGATAGAGGTGACCAGCTCATTTACAATGTTGGTGATTGATAATGTTACCAGATTTGACAGTGGTCGGTATAATCTGACATTAGAAAATAATAGTGGCTCCAAAACAGCTTTTG
TTAACGTCAGAGTTCTTGACTCACCAAGTGCCCCTGTGAATTTGACCATAAGAGAAGTGAAGAAAGACTCAGTGACGTTGTCCTGGGAACCACCACTTATTGATGGTGGAGCTAAGATTA
CAAACTACATTGTCGAAAAACGAGAAACTACAAGAAAAGCCTATGCTACCATTACAAATAATTGCACTAAAACTACTTTCAGAATTGAAAATCTACAAGAAGGATGTTCTTACTACTTCC
GAGTCTTGGCTTCCAATGAATATGGGATTGGTTTGCCAGCTGAAACAACAGAACCCGTTAAAGTGTCTGAACCACCCCTCCCACCTGGAAGAGTAACTCTTGTTGATGTGACCCGTAATA
CAGCTACAATTAAGTGGGAGAAACCAGAAAGTGATGGTGGCAGCAAAATTACTGGTTATGTGGTTGAAATGCAGACTAAAGGGAGTGAAAAGTGGAGCACCTGCACACAAGTTAAGACTC
TAGAAGCAACTATATCTGGCTTAACTGCAGGAGAAGAGTATGTCTTCAGGGTAGCTGCAGTTAACGAAAAGGGAAGAAGTGATCCAAGACAACTTGGAGTGCCAGTAATTGCAAGGGATA
TTGAAATAAAGCCTTCAGTTGAGCTTCCTTTCCATACTTTCAATGTAAAGGCTAGAGAACAACTTAAGATTGATGTGCCATTCAAAGGAAGACCTCAAGCTACTGTGAACTGGAGAAAAG
ATGGTCAGACTCTTAAAGAGACAACTAGAGTCAATGTTTCTTCTTCAAAGACTGTAACATCACTATCTATTAAGGAAGCTTCAAAGGAAGATGTTGGAACTTATGAATTATGTGTTTCAA
ACAGTGCTGGATCCATAACAGTTCCTATTACTATAATTGTCCTTGACAGACCAGGACCTCCAGGTCCTATACGTATTGATGAGGTTAGTTGTGACAGCATAACCATTTCTTGGAATCCTC
CAGAATATGATGGTGGCTGCCAAATTAGCAATTACATTGTTGAAAAGAAAGAAACCACCTCTACAACATGGCACATAGTTTCACAAGCAGTTGCAAGAACATCCATTAAAATAGTTCGCC
TGACAACAGGAAGTGAGTATCAGTTCCGTGTTTGTGCAGAAAACCGCTATGGAAAGAGCTCCTACAGTGAATCTTCAGCTGTTGTTGCAGAGTATCCATTCAGTCCCCCAGGTCCTCCTG
GTACTCCTAAAGTTGTGCATGCCACAAAATCTACCATGCTTGTAACCTGGCAAGTGCCAGTTAATGATGGAGGAAGTCGAGTAATTGGCTATCATCTTGAGTATAAAGAAAGAAGCAGCA
TTCTTTGGTCAAAAGCAAATAAAATCCTCATTGCTGATACTCAAATGAAAGTCTCCGGCCTTGATGAAGGACTGATGTATGAGTATCGTGTATATGCTGAAAATATTGCTGGAATTGGTA
AATGCAGTAAATCTTGTGAACCAGTCCCTGCAAGAGATCCTTGTGACCCTCCTGGACAACCTGAAGTCACAAATATCACAAGAAAATCAGTGTCACTTAAATGGTCTAAACCACATTATG
ATGGTGGAGCTAAGATCACAGGATACATTGTTGAACGCAGAGAACTACCAGATGGCCGGTGGCTGAAGTGCAATTATACTAATATACAAGAAACATACTTTGAAGTAACTGAACTTACTG
AAGATCAGCGTTATGAATTCCGGGTTTTTGCAAGGAATGCTGCTGACTCAGTTAGTGAGCCATCTGAATCCACTGGGCCTATTATAGTTAAAGATGATGTTGAGCCTCCAAGAGTTATGA
TGGATGTCAAGTTCCGAGACGTTATTGTTGTCAAAGCTGGAGAGGTCCTTAAGATAAATGCAGACATTGCAGGGCGACCTCTGCCAGTAATTTCCTGGGCCAAGGATGGTATAGAAATTG
AAGAAAGAGCAAGAACAGAAATCATCTCAACAGACAATCATACTTTGTTAACAGTTAAAGACTGTATAAGACGAGACACTGGGCAATATGTACTAACACTGAAGAATGTTGCCGGCACTC
GGTCTGTGGCCGTTAATTGCAAAGTACTTGATAAGCCTGGTCCACCAGCAGGACCACTTGAAATAAATGGCCTCACTGCTGAGAAATGCTCTCTTTCCTGGGGACGTCCCCAAGAAGATG
GTGGTGCAGATATCGACTATTACATCGTAGAAAAACGTGAAACAAGCCACCTTGCATGGACAATATGTGAAGGAGAGTTACAGATGACATCCTGTAAAGTAACCAAGTTACTCAAAGGCA
ATGAATATATATTTAGAGTAACTGGTGTTAATAAATATGGTGTTGGTGAGCCCCTAGAGAGTGTAGCTATAAAGGCACTAGATCCATTTACAGTTCCAAGTCCACCCACGTCTTTGGAAA
TTACTTCTGTGACCAAAGAATCTATGACACTTTGCTGGTCAAGACCCGAGAGTGATGGAGGTAGTGAAATATCTGGATATATAATTGAAAGGCGAGAGAAAAATAGCCTAAGATGGGTGC
GTGTAAACAAAAAACCAGTTTATGATCTAAGAGTGAAATCAACAGGACTTCGGGAAGGATGTGAATATGAATATCGTGTTTATGCAGAAAATGCTGCTGGCCTAAGTCTTCCAAGTGAAA
CCTCTCCCTTAATTAGGGCAGAAGATCCAGTGTTCCTACCATCTCCTCCATCCAAACCCAAAATTGTGGACTCAGGCAAGACAACTATAACTATTGCCTGGGTTAAGCCGCTGTTTGATG
GTGGGGCCCCGATAACTGGATATACTGTAGAATACAAAAAATCTGATGACACTGACTGGAAAACTTCCATTCAGAGCTTACGAGGGACAGAATATACAATAAGCGGACTAACAACAGGAG
CTGAATATGTTTTCAGAGTAAAATCTGTCAATAAGGTTGGTGCTAGTGACCCCAGTGATAGCTCTGACCCTCAGATAGCAAAGGAAAGAGAAGAAGAACCTTTATTTGATATTGACAGTG
AAATGAGGAAGACCTTGATTGTCAAGGCTGGTGCCTCATTTACCATGACTGTGCCTTTCCGAGGAAGACCAGTACCCAATGTCTTGTGGAGTAAGCCAGACACTGACCTCCGTACTAGAG
CTTATGTTGATACCACAGACTCTCGTACATCACTGACCATTGAAAATGCCAACAGAAATGACTCTGGAAAGTACACATTAACAATTCAGAATGTTTTGAGTGCTGCTTCACTGACCTTAG
TTGTCAAAGTTTTAGATACCCCAGGTCCTCCAACCAACATTACTGTGCAAGATGTAACCAAAGAGTCTGCAGTGTTATCCTGGGATGTTCCTGAAAACGATGGTGGAGCACCAGTGAAGA
ATTACCACATAGAAAAACGTGAGGCCAGCAAGAAAGCATGGGTCTCTGTGACCAACAACTGTAACCGCCTCTCCTACAAAGTTACCAATTTACAAGAAGGAGCTATCTATTACTTCAGAG
TCTCTGGAGAAAATGAGTTTGGTGTTGGTATACCAGCTGAAACAAAGGAAGGAGTAAAAATAACAG

ATGC = coding sequence, ATGC = non-coding sequence