Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 359

Details for Exon 359 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 359 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,400,576 179,394,968 299,954 305,562100,766 106,374

Transcripts

Exon 359 occurs in the following Titin transcripts (the number indicates the exon rank of exon 359 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
358 308 186 307 187 187 -

Functional Data

Region: This exon occurs in the M-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Ig-like 142, Fibronectin type-III 132, Protein kinase, Ig-like 143/144/145/146/147/148.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 100% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is assymmetric, i.e. the length of the exon is not a multiple of three and therefore removal of it will alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
STM 2015DCM-PRO14CT01557c.101996G>Ap.Trp33999Xnonsense
STM 2015DCM-ES20RD01346c.101021_101022delGAp.Arg33674fsframeshift
STM 2015DCM-REPLEB-III-2c.101098_101099insTp.Asp33700fsframeshift
STM 2015JHSJ551172c.106374+1delGessential splice site
STM 2015JHSJ541798c.102630_102630delAp.K34210fsframeshift
STM 2015JHSJ542193c.103408G>Tp.E34470*nonsense
STM 2015JHSJ316117c.104092C>Tp.R34698*nonsense
LMM 2014ALL-CASES118c.102949C>Tp.Gln34317Xnonsense

Sequence

Size of Exon: 5609 bases           Ensembl ID: ENSE00001593660

TTCCAGCTAAGATACACTTACCTAAAACTCTTGAAGGCATGGGAGCAGTTCATGCTCTCCGAGGTGAAGTGGTCAGCATCAAGATTCCTTTCAGTGGCAAACCAGATCCTGTGATCACCT
GGCAGAAAGGACAAGATCTCATTGACAATAATGGCCACTACCAAGTTATTGTCACAAGATCCTTCACATCACTTGTTTTCCCCAATGGGGTAGAGAGAAAAGATGCTGGTTTCTATGTGG
TCTGTGCTAAAAACAGATTTGGAATTGATCAGAAGACAGTTGAACTGGATGTGGCTGATGTTCCTGACCCACCCAGAGGAGTCAAAGTTAGTGATGTCTCACGAGATTCTGTCAACTTAA
CATGGACTGAGCCAGCCTCTGATGGTGGCAGCAAAATCACCAACTACATTGTTGAAAAATGTGCAACTACTGCAGAAAGATGGCTCCGTGTAGGACAGGCCCGAGAAACACGTTATACCG
TGATCAACTTATTTGGAAAAACAAGTTACCAGTTCCGGGTAATAGCTGAAAATAAATTTGGTCTGAGCAAGCCTTCAGAGCCTTCAGAACCAACCATAACCAAAGAAGATAAGACCAGAG
CTATGAACTATGATGAAGAGGTAGATGAAACCAGGGAAGTCTCCATGACTAAAGCATCTCACTCTTCAACCAAGGAACTCTATGAGAAATATATGATTGCTGAAGATCTTGGGCGTGGTG
AGTTTGGAATTGTCCATCGTTGTGTTGAAACATCCTCAAAGAAGACATACATGGCCAAATTTGTTAAAGTCAAAGGGACTGATCAGGTTTTGGTAAAGAAGGAAATTTCCATTCTGAATA
TTGCTAGGCATAGAAACATCTTACACCTCCATGAATCATTTGAAAGCATGGAAGAATTAGTTATGATCTTTGAGTTTATATCAGGACTTGACATATTTGAGCGCATTAACACAAGTGCTT
TTGAACTTAATGAAAGAGAAATTGTAAGTTATGTTCACCAGGTCTGTGAAGCACTTCAGTTTTTACACAGTCATAATATTGGACACTTTGACATTAGACCAGAAAATATCATTTACCAAA
CCAGAAGAAGCTCTACCATTAAAATCATAGAATTTGGTCAAGCCCGTCAGCTGAAACCAGGGGACAACTTCAGGCTTCTATTCACTGCCCCAGAATACTATGCACCTGAAGTCCACCAGC
ATGATGTTGTCAGCACAGCCACAGACATGTGGTCACTTGGAACACTGGTATATGTGCTATTGAGTGGTATCAACCCATTCCTGGCTGAAACTAACCAACAGATCATTGAGAATATCATGA
ATGCTGAATATACTTTCGATGAGGAAGCATTCAAAGAGATTAGCATTGAAGCCATGGATTTTGTTGACCGGTTGTTAGTGAAAGAGAGGAAATCTCGCATGACAGCATCGGAGGCTCTCC
AGCACCCATGGTTGAAGCAGAAGATAGAAAGAGTCAGTACTAAAGTTATCAGAACATTAAAACACCGGCGTTATTACCACACCCTGATCAAGAAAGACCTCAACATGGTTGTGTCAGCAG
CCCGGATCTCCTGTGGTGGTGCAATTCGATCTCAGAAGGGAGTGAGTGTTGCTAAAGTTAAAGTGGCATCCATTGAAATTGGCCCAGTTTCTGGGCAGATAATGCATGCAGTTGGTGAAG
AAGGAGGACATGTCAAATATGTATGCAAAATTGAAAATTATGATCAGTCTACCCAAGTGACTTGGTACTTTGGCGTCCGACAGCTGGAGAACAGTGAGAAATACGAAATCACCTACGAAG
ATGGAGTGGCCATCCTCTATGTCAAAGACATTACCAAATTAGATGATGGTACCTACAGATGCAAAGTAGTCAATGACTATGGTGAAGACAGTTCTTATGCAGAGCTATTTGTTAAAGGTG
TGAGAGAAGTCTATGACTATTACTGCCGTAGAACCATGAAGAAAATTAAGCGCAGAACAGACACAATGAGACTCCTGGAAAGGCCACCAGAATTTACCCTGCCTCTCTATAATAAGACAG
CTTATGTAGGTGAAAATGTCCGGTTTGGAGTAACTATAACTGTCCACCCAGAGCCTCATGTAACATGGTATAAATCAGGTCAGAAAATCAAACCAGGTGACAATGACAAGAAGTACACAT
TTGAGTCAGACAAGGGTCTTTACCAATTAACAATCAACAGTGTCACTACAGATGATGACGCTGAATATACTGTTGTGGCAAGGAACAAATATGGTGAAGACAGCTGTAAAGCAAAGCTGA
CAGTAACCCTACACCCACCTCCAACAGATAGTACCTTAAGACCCATGTTCAAAAGGTTACTGGCAAATGCAGAATGCCAAGAAGGCCAAAGTGTCTGCTTTGAGATCAGAGTGTCTGGCA
TCCCCCCACCAACATTAAAATGGGAGAAAGATGGTCAGCCACTGTCCCTCGGGCCTAACATTGAAATTATCCATGAAGGCTTGGATTATTATGCTCTGCACATCAGGGACACTTTGCCTG
AAGACACGGGTTATTATAGAGTCACAGCCACTAACACAGCTGGGTCCACCAGCTGCCAGGCTCACCTACAAGTGGAACGCCTGAGGTACAAGAAACAGGAATTCAAGAGTAAGGAGGAGC
ATGAGCGACACGTACAAAAACAAATTGACAAAACCCTCAGAATGGCTGAAATTCTTTCTGGAACTGAAAGTGTACCACTGACACAGGTAGCTAAAGAGGCTCTGAGAGAAGCTGCTGTCC
TTTATAAACCGGCTGTAAGCACCAAGACTGTAAAAGGGGAATTCAGACTTGAGATAGAAGAAAAGAAGGAGGAGAGAAAACTCCGGATGCCTTATGATGTACCAGAGCCACGCAAGTATA
AGCAGACTACCATAGAAGAAGACCAACGCATCAAGCAGTTCGTGCCCATGTCTGACATGAAGTGGTATAAAAAGATACGTGATCAGTATGAAATGCCTGGGAAACTTGACAGAGTTGTAC
AGAAACGACCCAAGCGCATCCGCCTTTCAAGATGGGAACAGTTCTATGTGATGCCTCTTCCACGCATTACAGATCAATACAGACCTAAATGGCGTATTCCTAAACTGTCCCAAGATGATC
TTGAGATAGTGAGACCAGCCCGCCGGCGTACACCTTCTCCTGATTATGACTTTTACTACCGACCTAGAAGACGTTCTCTTGGGGACATCTCTGATGAAGAATTACTCCTCCCCATTGATG
ACTACTTAGCAATGAAAAGAACAGAGGAAGAGAGGCTGCGTCTTGAAGAAGAGCTTGAGTTAGGTTTTTCAGCTTCACCCCCAAGTCGAAGCCCTCCACACTTTGAGCTTTCTAGCCTAC
GTTACTCTTCACCACAAGCTCATGTCAAGGTGGAGGAAACAAGAAAAGACTTCAGGTATTCAACCTATCACATCCCAACGAAGGCTGAAGCTAGTACAAGTTATGCAGAACTGAGGGAAC
GGCATGCCCAGGCTGCGTACAGACAGCCAAAGCAACGGCAAAGAATCATGGCTGAGAGGGAGGATGAAGAGTTGCTTCGCCCAGTTACGACCACCCAGCATCTCTCAGAATACAAAAGCG
AACTTGACTTCATGTCAAAGGAGGAAAAGTCTAGAAAGAAATCAAGGCGACAAAGAGAAGTGACAGAAATAACAGAAATTGAGGAAGAATACGAAATCTCAAAACATGCTCAAAGAGAAT
CATCCTCATCTGCGTCTAGACTACTGAGACGACGGCGCTCCCTGTCTCCAACTTATATTGAGTTAATGAGGCCAGTGTCTGAGCTGATCCGGTCACGTCCACAACCGGCTGAGGAATACG
AAGATGACACAGAAAGAAGGTCACCTACTCCAGAGAGAACTCGCCCACGATCCCCCAGCCCTGTGTCTAGTGAGAGATCACTCTCGAGATTTGAGAGGTCTGCAAGATTTGATATCTTTT
CCAGGTATGAGTCCATGAAAGCTGCTTTAAAAACTCAGAAGACATCAGAAAGGAAGTATGAAGTTTTGAGTCAGCAGCCTTTCACACTGGACCATGCCCCTCGAATCACACTGAGAATGC
GCTCGCACAGGGTACCATGTGGCCAAAATACACGTTTTATTTTAAATGTTCAGTCTAAGCCAACTGCCGAGGTTAAATGGTACCACAATGGTGTGGAACTCCAAGAAAGCAGTAAGATTC
ATTACACCAACACGAGTGGAGTCCTCACCCTGGAAATTCTGGACTGTCATACTGATGACAGTGGAACCTACCGTGCTGTGTGCACCAACTACAAGGGCGAAGCTTCTGACTATGCAACGT
TGGACGTGACAGGAGGGGATTATACCACCTATGCTTCCCAACGCAGAGATGAAGAGGTCCCCAGATCTGTTTTCCCTGAGCTGACAAGAACAGAGGCGTATGCTGTTTCATCATTTAAGA
AAACATCTGAGATGGAAGCTTCGTCTTCTGTCAGGGAAGTGAAATCACAGATGACGGAGACAAGGGAAAGTCTCTCCTCATATGAACACTCTGCATCTGCAGAAATGAAAAGTGCTGCAT
TAGAAGAAAAGTCACTGGAAGAAAAATCCACAACCAGAAAGATCAAGACGACTTTGGCAGCAAGAATTCTAACAAAGCCACGGTCCATGACCGTCTACGAGGGCGAGTCTGCAAGGTTTT
CTTGTGACACCGATGGTGAGCCGGTACCAACTGTGACCTGGCTGCGTAAAGGACAAGTGCTAAGTACTTCTGCCCGCCACCAAGTGACCACCACAAAGTACAAATCAACCTTTGAGATCT
CTTCAGTCCAGGCTTCCGATGAGGGCAATTACAGCGTGGTGGTAGAAAACAGTGAAGGGAAACAAGAAGCAGAGTTCACTCTGACTATTCAAAAGGCCAGGGTAACTGAAAAGGCTGTGA
CATCACCACCAAGAGTCAAATCCCCAGAGCCTCGGGTGAAATCCCCAGAAGCAGTTAAGTCTCCAAAACGAGTGAAATCTCCAGAACCTTCTCACCCGAAAGCCGTATCACCCACAGAGA
CAAAACCAACACCAACAGAGAAAGTTCAGCACCTCCCAGTCTCTGCCCCACCAAAGATTACTCAGTTCCTGAAAGCAGAAGCTTCTAAAGAGATTGCAAAACTGACCTGTGTGGTTGAAA
GCAGTGTATTAAGGGCAAAAGAGGTCACCTGGTATAAAGATGGCAAGAAACTGAAGGAAAATGGGCATTTCCAGTTTCATTATTCAGCAGATGGTACCTATGAGCTCAAAATCAATAACC
TCACTGAATCTGATCAAGGAGAATATGTTTGTGAGATTTCTGGTGAAGGTGGAACGTCTAAAACCAACTTACAATTTATGGGGCAAGCCTTTAAGAGTATCCATGAGAAGGTATCAAAAA
TATCAGAAACTAAGAAATCAGATCAGAAAACCACTGAGTCAACAGTAACCAGAAAAACTGAACCAAAAGCTCCTGAACCAATTTCCTCAAAACCAGTAATTGTTACTGGGTTGCAGGATA
CAACTGTTTCTTCAGACAGTGTTGCTAAATTTGCAGTTAAGGCTACTGGAGAACCCCGGCCAACTGCCATCTGGACAAAAGATGGAAAG

ATGC = coding sequence, ATGC = non-coding sequence