Titin Variants in Dilated Cardiomyopathy

TTN Transcript / Exon Structure & Truncating Variants in Cardiomyopathy Studies

Titin - Exon 49

Details for Exon 49 of the Titin gene - Sequence Coordinates, Associated Transcripts, Functional Data, Truncating Variants and Sequence.

The exon number is based on the LRG numbering, as recommended for clinical reporting.

Coordinates

The genomic coordinates of HG19 and Locus Reference Genomic (LRG) and the CDS coordinates of the Titin meta-transcript for exon 49 are displayed below.

HG19 Genomic Locus Reference Genomic Meta-Transcript
StartEnd StartEnd StartEnd
179,606,648 179,603,868 93,882 96,66211,312 14,092

Transcripts

Exon 49 occurs in the following Titin transcripts (the number indicates the exon rank of exon 49 in each transcript).

METAN2BAN2BN2ANOVEX-1NOVEX-2NOVEX-3
48 46 45 - 46 46 -

Functional Data

Region: This exon occurs in the I-band region of the titin protein.

Domains: This exon codes for the following domain(s) - Ig-like 21/22/23.

PSI: The "proportion spliced-in" (an estimate of the percentage of TTN transcripts that incorporate this exon based on RNAseq data) is 100% in DCM (LV tissue of 84 end-stage patients) and 95% in GTEx (LV tissue of 105 samples from Genotype-Tissue Expression project). (See Ref. 1 for details)

Symmetry: This exon is symmetric, i.e. the length of the exon is a multiple of three and therefore removal of it will not alter the reading frame.

References
1. A. M. Roberts, J. S. Ware, D. S. Herman et al. Integrated allelic, transcriptional, and phenomic dissection of the cardiac effects of titin truncations in health and disease. Sci. Transl. Med. 7, 270ra6 (2015).

Truncating Variants

The following TTN truncating variants affecting this exon have been described in major published studies (click on the study name for more details):

StudyCohortPatient IDVariant (CDS)Variant (protein)Variant Type
PAED 2016CHILDRENDCM-22c.13966C>Tp.Q4656Xnonsense
STM 2015DCM-PRO10DW00512c.12643_12644delCAp.Gln4215ValfsX16frameshift
STM 2015DCM-PRO14MW01583c.12757C>Tp.Gln4253Xnonsense
STM 2015DCM-REPLL-III-1c.14056delp.Thr4686fsframeshift
STM 2015DCM-REPLLW-II-3c.11912G>Ap.Trp3971*nonsense
STM 2015DCM-REPLBA-III-3c.13900G>Tp.Glu4634*nonsense
LMM 2014ALL-CASES155c.11657delAp.Asp3886ValfsX22frameshift
LMM 2014ALL-CASES157c.12587C>Ap.Ser4196Xnonsense
NEJM 2012DCM-AHFA-42c.13696C>Tp.Gln4566Xnonsense
NEJM 2012Controlspv-1c.13010delAp.Lys4337fsframeshift

Sequence

Size of Exon: 2781 bases           Ensembl ID: ENSE00001328652

AGTTTTCTAGTTCTTTTCTGTCTGCCGAGGAAGAAGGACTTCATAGCGCCGAACTTCAATTATCTAAAATAAATGAAACACTTGAACTTTTGTCTGAATCTCCAGTTTACCCAACTAAAT
TTGATTCCGAAAAGGAAGGCACTGGCCCAATTTTCATCAAAGAAGTGTCAAATGCTGATATAAGCATGGGGGATGTGGCTACACTGTCTGTAACTGTCATTGGCATCCCCAAACCTAAAA
TTCAGTGGTTCTTTAATGGAGTGCTATTAACCCCTTCTGCTGACTACAAATTTGTTTTTGACGGTGATGATCATAGCCTGATCATTCTGTTCACCAAATTGGAGGATGAGGGAGAGTATA
CATGTATGGCCAGTAATGACTATGGAAAGACAATATGTAGTGCCTATCTAAAAATTAATTCCAAAGGAGAGGGTCACAAAGACACTGAAACAGAATCAGCAGTGGCAAAATCTCTGGAAA
AGCTGGGAGGTCCTTGTCCTCCTCACTTCCTTAAGGAGTTAAAACCAATTCGCTGTGCTCAAGGGCTTCCTGCCATCTTTGAGTACACAGTGGTTGGAGAGCCTGCCCCTACTGTTACAT
GGTTCAAAGAAAACAAGCAGCTTTGCACCAGTGTTTATTACACTATCATTCATAACCCTAATGGCTCTGGAACTTTCATTGTCAATGACCCTCAGAGGGAAGACAGTGGCCTCTATATCT
GTAAAGCAGAGAATATGTTGGGTGAGTCCACCTGTGCAGCAGAGCTGCTTGTGCTTCTGGAAGACACAGACATGACTGATACCCCCTGCAAAGCAAAGTCCACACCAGAGGCTCCTGAGG
ATTTTCCACAGACACCCTTAAAGGGTCCCGCAGTTGAAGCACTTGACTCAGAGCAGGAAATTGCAACGTTTGTAAAAGACACCATTTTGAAAGCTGCTTTAATTACAGAAGAAAACCAGC
AACTATCTTATGAGCATATTGCTAAAGCCAATGAATTGAGCAGTCAGCTTCCTTTGGGAGCTCAGGAATTGCAATCCATTTTGGAGCAAGACAAGCTCACTCCTGAAAGCACCAGGGAAT
TTCTTTGCATCAATGGCAGTATTCACTTTCAGCCTCTCAAGGAACCATCTCCCAACCTACAGCTGCAGATTGTACAGTCCCAGAAAACCTTCTCCAAAGAAGGTATTCTAATGCCTGAAG
AGCCTGAGACACAGGCAGTTCTATCAGATACCGAGAAAATCTTCCCAAGTGCCATGTCCATAGAACAAATTAATTCATTAACAGTTGAGCCTCTGAAAACTTTATTAGCTGAACCTGAAG
GGAATTATCCACAGTCTTCAATAGAACCTCCAATGCATTCTTATCTAACCTCTGTGGCTGAGGAAGTACTTTCACCAAAAGAAAAGACAGTATCTGACACCAACAGAGAGCAAAGAGTGA
CTCTTCAAAAGCAAGAGGCACAAAGTGCGCTCATCTTGAGTCAGAGCTTAGCTGAGGGACACGTGGAGAGTCTCCAGAGTCCTGATGTCATGATCTCTCAGGTAAACTATGAGCCCCTAG
TCCCTTCAGAACACTCATGCACAGAAGGAGGTAAAATTTTGATAGAAAGTGCAAATCCACTGGAAAATGCAGGGCAAGATTCTGCGGTCAGAATTGAGGAAGGCAAGTCCTTAAGATTTC
CACTAGCACTTGAAGAAAAGCAGGTACTGCTCAAAGAAGAGCATTCTGACAACGTGGTGATGCCCCCAGACCAAATCATTGAGTCTAAAAGAGAGCCCGTGGCAATAAAGAAAGTGCAGG
AGGTACAGGGAAGGGACCTTCTTTCTAAGGAAAGCTTGCTTTCTGGTATTCCAGAAGAGCAGAGATTAAACCTGAAAATTCAAATCTGCCGGGCTTTGCAAGCAGCCGTGGCCAGCGAGC
AGCCAGGTCTTTTCTCTGAGTGGCTAAGAAATATTGAAAAGGTGGAGGTCGAGGCTGTAAACATCACCCAAGAGCCCAGACACATCATGTGCATGTACCTTGTTACTTCGGCAAAGTCTG
TAACAGAAGAAGTAACCATCATTATTGAAGATGTTGATCCTCAAATGGCTAACCTGAAAATGGAACTTAGGGATGCTTTGTGTGCTATTATATATGAGGAAATAGACATCCTAACAGCTG
AGGGTCCTAGAATTCAGCAAGGAGCCAAAACAAGTTTGCAAGAAGAAATGGATTCTTTTTCAGGTTCACAGAAGGTTGAACCCATTACTGAACCAGAAGTTGAATCTAAATATCTGATCT
CAACTGAAGAGGTCAGTTATTTTAACGTGCAAAGTAGGGTTAAATATTTGGATGCCACACCTGTCACTAAAGGGGTTGCTTCAGCTGTTGTCTCTGACGAAAAACAAGATGAGAGTCTGA
AACCATCAGAGGAAAAAGAGGAGTCTTCCTCTGAAAGTGGTACTGAGGAGGTTGCTACAGTAAAGATACAGGAAGCTGAGGGTGGCTTAATCAAAGAGGATGGCCCCATGATACATACAC
CTTTAGTGGACACTGTTTCTGAGGAAGGTGATATTGTACACCTCACAACATCCATAACAAATGCTAAAGAGGTGAATTGGTATTTTGAGAATAAACTGGTGCCTTCAGATGAAAAGTTCA
AGTGTTTACAAGATCAAAATACATATACGCTAGTCATCGACAAAGTAAATACCGAAGACCATCAAGGAGAGTATGTCTGTGAGGCCTTGAATGACAGCGGAAAAACAGCAACTTCAGCCA
AACTCACTGTAGTAAAAAGAG

ATGC = coding sequence, ATGC = non-coding sequence